ID: 1160967638_1160967650

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1160967638 1160967650
Species Human (GRCh38) Human (GRCh38)
Location 19:1753623-1753645 19:1753668-1753690
Sequence CCGGCGCTGAGGAGCGCGCGCGG GCTGAGCCTGGAGAGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103} {0: 1, 1: 0, 2: 12, 3: 69, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!