ID: 1160970495_1160970511

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1160970495 1160970511
Species Human (GRCh38) Human (GRCh38)
Location 19:1765795-1765817 19:1765836-1765858
Sequence CCCGCGTCCCCATGGCTGCAGTG GGCAGAGAGGAGCCCACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!