ID: 1160972459_1160972472

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1160972459 1160972472
Species Human (GRCh38) Human (GRCh38)
Location 19:1775634-1775656 19:1775670-1775692
Sequence CCTTCCTCCCTCCATGCCCACTC GGAAGCCCTCCACCCCCCCCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 14, 3: 203, 4: 1975} {0: 1, 1: 0, 2: 4, 3: 34, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!