ID: 1160977384_1160977387

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1160977384 1160977387
Species Human (GRCh38) Human (GRCh38)
Location 19:1799941-1799963 19:1799960-1799982
Sequence CCGCACCATAGACGCGGCCGCTG GCTGATGCAGCACTTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38} {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!