ID: 1160982671_1160982677

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1160982671 1160982677
Species Human (GRCh38) Human (GRCh38)
Location 19:1823514-1823536 19:1823529-1823551
Sequence CCTCTCCTGCCCACATGCCCACG TGCCCACGGCCCCCCGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 436} {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!