ID: 1160995350_1160995365

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1160995350 1160995365
Species Human (GRCh38) Human (GRCh38)
Location 19:1879790-1879812 19:1879837-1879859
Sequence CCTGTGCATCCACTGTGGCTCCC TCCCAGGGAAGCCCGCCCCCCGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 1, 3: 28, 4: 271} {0: 6, 1: 0, 2: 1, 3: 28, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!