ID: 1160995355_1160995365

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1160995355 1160995365
Species Human (GRCh38) Human (GRCh38)
Location 19:1879811-1879833 19:1879837-1879859
Sequence CCCTCCTGCAGGGCCGCCCACCT TCCCAGGGAAGCCCGCCCCCCGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 1, 3: 34, 4: 283} {0: 6, 1: 0, 2: 1, 3: 28, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!