ID: 1160995360_1160995365

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160995360 1160995365
Species Human (GRCh38) Human (GRCh38)
Location 19:1879824-1879846 19:1879837-1879859
Sequence CCGCCCACCTTCCTCCCAGGGAA TCCCAGGGAAGCCCGCCCCCCGG
Strand - +
Off-target summary {0: 9, 1: 4, 2: 9, 3: 79, 4: 672} {0: 6, 1: 0, 2: 1, 3: 28, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!