ID: 1160995374_1160995393

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1160995374 1160995393
Species Human (GRCh38) Human (GRCh38)
Location 19:1879855-1879877 19:1879902-1879924
Sequence CCCGGCCCCCCGCCTGGTCCCCT CCCCCAGGGTCGCCCTCACCTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 4, 3: 61, 4: 632} {0: 5, 1: 3, 2: 6, 3: 24, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!