ID: 1160995376_1160995393

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1160995376 1160995393
Species Human (GRCh38) Human (GRCh38)
Location 19:1879860-1879882 19:1879902-1879924
Sequence CCCCCCGCCTGGTCCCCTCTTGG CCCCCAGGGTCGCCCTCACCTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 6, 3: 25, 4: 252} {0: 5, 1: 3, 2: 6, 3: 24, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!