ID: 1160995378_1160995398

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1160995378 1160995398
Species Human (GRCh38) Human (GRCh38)
Location 19:1879861-1879883 19:1879911-1879933
Sequence CCCCCGCCTGGTCCCCTCTTGGG TCGCCCTCACCTGGTGCGCAGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 8, 3: 15, 4: 191} {0: 10, 1: 1, 2: 0, 3: 6, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!