ID: 1160995394_1160995407

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160995394 1160995407
Species Human (GRCh38) Human (GRCh38)
Location 19:1879903-1879925 19:1879943-1879965
Sequence CCCCAGGGTCGCCCTCACCTGGT CGGCGTCGATGTCGGCATAGAGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 2, 3: 22, 4: 159} {0: 5, 1: 3, 2: 4, 3: 1, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!