ID: 1161014993_1161015000

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161014993 1161015000
Species Human (GRCh38) Human (GRCh38)
Location 19:1979083-1979105 19:1979100-1979122
Sequence CCTGGGCAAGGGTGAGCTGCGCG TGCGCGCGCGCGGCGGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 115} {0: 1, 1: 0, 2: 14, 3: 77, 4: 622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!