ID: 1161017738_1161017753

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1161017738 1161017753
Species Human (GRCh38) Human (GRCh38)
Location 19:1991592-1991614 19:1991639-1991661
Sequence CCGGGATGCCCTGCATCTGACCT CTGGGTCCTTTCCAGGATGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 31, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!