ID: 1161041116_1161041121

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1161041116 1161041121
Species Human (GRCh38) Human (GRCh38)
Location 19:2111228-2111250 19:2111246-2111268
Sequence CCCATGCCAAAGAGTGTGGGCTG GGCTGGCCCACCCTGCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149} {0: 1, 1: 0, 2: 4, 3: 46, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!