ID: 1161043787_1161043791

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1161043787 1161043791
Species Human (GRCh38) Human (GRCh38)
Location 19:2123762-2123784 19:2123775-2123797
Sequence CCCGCCTGTGGAAAGGTGTGGCC AGGTGTGGCCTCTGCAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 263} {0: 1, 1: 0, 2: 2, 3: 26, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!