ID: 1161055653_1161055659

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1161055653 1161055659
Species Human (GRCh38) Human (GRCh38)
Location 19:2189550-2189572 19:2189582-2189604
Sequence CCTGAAATCTCCTGCATCAGGGC GGCTTCTGCCAGAAGGGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131} {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!