ID: 1161055655_1161055661

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1161055655 1161055661
Species Human (GRCh38) Human (GRCh38)
Location 19:2189560-2189582 19:2189590-2189612
Sequence CCTGCATCAGGGCGGAAAGCGAG CCAGAAGGGTCTTGGCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71} {0: 1, 1: 0, 2: 0, 3: 25, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!