ID: 1161063538_1161063548

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1161063538 1161063548
Species Human (GRCh38) Human (GRCh38)
Location 19:2226909-2226931 19:2226929-2226951
Sequence CCTTCCTGGGCCCCTTCCCGCCG CCGGGACCGCAGTTCGCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 39, 4: 342} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!