ID: 1161063542_1161063550

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1161063542 1161063550
Species Human (GRCh38) Human (GRCh38)
Location 19:2226919-2226941 19:2226946-2226968
Sequence CCCCTTCCCGCCGGGACCGCAGT GCTCGGCCCCATGTCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93} {0: 1, 1: 0, 2: 1, 3: 16, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!