ID: 1161068753_1161068764

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1161068753 1161068764
Species Human (GRCh38) Human (GRCh38)
Location 19:2250354-2250376 19:2250386-2250408
Sequence CCCTCGCTGAGGTTCCAGGAGCC AGGAGCTGGCCCCCCAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184} {0: 1, 1: 0, 2: 4, 3: 29, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!