ID: 1161072511_1161072530

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161072511 1161072530
Species Human (GRCh38) Human (GRCh38)
Location 19:2269911-2269933 19:2269944-2269966
Sequence CCCCCCGGCCTTAGCAGTGCTCT GGGTTTGGGGGGCAAGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 105} {0: 1, 1: 5, 2: 22, 3: 190, 4: 1490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!