ID: 1161072694_1161072703

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1161072694 1161072703
Species Human (GRCh38) Human (GRCh38)
Location 19:2270512-2270534 19:2270558-2270580
Sequence CCGGGGAGCTGGGGGTGGCGCAC GGAAGACCCCCGCCGCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 141, 4: 864} {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!