ID: 1161072694_1161072704

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1161072694 1161072704
Species Human (GRCh38) Human (GRCh38)
Location 19:2270512-2270534 19:2270559-2270581
Sequence CCGGGGAGCTGGGGGTGGCGCAC GAAGACCCCCGCCGCTTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 141, 4: 864} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!