ID: 1161072909_1161072916

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1161072909 1161072916
Species Human (GRCh38) Human (GRCh38)
Location 19:2271232-2271254 19:2271250-2271272
Sequence CCTCGGGGGTGTGGGACCGGGTG GGGTGGGCCCCTGCCTGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162} {0: 1, 1: 0, 2: 2, 3: 60, 4: 669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!