ID: 1161076316_1161076325

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1161076316 1161076325
Species Human (GRCh38) Human (GRCh38)
Location 19:2287504-2287526 19:2287538-2287560
Sequence CCCTGGGCCATCTGTACATCGTG GGCCCTCCCGGCCACAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 65} {0: 1, 1: 0, 2: 1, 3: 26, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!