ID: 1161104021_1161104027

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1161104021 1161104027
Species Human (GRCh38) Human (GRCh38)
Location 19:2434465-2434487 19:2434486-2434508
Sequence CCCGGCCATGGCCTCCTCCAGCT CTCCCGAATGCGATCTTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 486} {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!