ID: 1161114179_1161114192

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1161114179 1161114192
Species Human (GRCh38) Human (GRCh38)
Location 19:2487844-2487866 19:2487887-2487909
Sequence CCACCGCCAAGAGCCCAGCCCTC AGCTTCCCAGCTCTAGGCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!