ID: 1161114193_1161114205

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161114193 1161114205
Species Human (GRCh38) Human (GRCh38)
Location 19:2487892-2487914 19:2487931-2487953
Sequence CCCAGCTCTAGGCCTTGGCCCCT GGTCGGGGCAGTGCCCAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!