ID: 1161153273_1161153287

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1161153273 1161153287
Species Human (GRCh38) Human (GRCh38)
Location 19:2720583-2720605 19:2720624-2720646
Sequence CCAGACGTCCAGGCAGGGCCAAT CCTGAAGCCCGGCTCCCGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!