ID: 1161155001_1161155003

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1161155001 1161155003
Species Human (GRCh38) Human (GRCh38)
Location 19:2727943-2727965 19:2727969-2727991
Sequence CCGGAGTTAATTCTCCAGCTTGC GCTGAGAGACGCCCCCATCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!