ID: 1161169325_1161169327

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1161169325 1161169327
Species Human (GRCh38) Human (GRCh38)
Location 19:2805133-2805155 19:2805152-2805174
Sequence CCAGGAGGAAAGTGGAGGAGGCC GGCCTTCAACTGCCGGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 356} {0: 1, 1: 0, 2: 1, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!