ID: 1161170907_1161170916

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1161170907 1161170916
Species Human (GRCh38) Human (GRCh38)
Location 19:2812096-2812118 19:2812143-2812165
Sequence CCTTCCGGGATCTGCGTGATCGG ACCCTTCTCTGGAGAAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22} {0: 1, 1: 0, 2: 4, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!