ID: 1161195213_1161195214

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1161195213 1161195214
Species Human (GRCh38) Human (GRCh38)
Location 19:2982835-2982857 19:2982849-2982871
Sequence CCGGTCAGTTGCTTTGGACAGAG TGGACAGAGAGAGCCTGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!