ID: 1161198836_1161198839

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1161198836 1161198839
Species Human (GRCh38) Human (GRCh38)
Location 19:3003005-3003027 19:3003019-3003041
Sequence CCCTTTGGATATTGGGGGGTGCC GGGGGTGCCCAGCACCATCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 32, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!