ID: 1161208916_1161208926

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1161208916 1161208926
Species Human (GRCh38) Human (GRCh38)
Location 19:3056337-3056359 19:3056363-3056385
Sequence CCGTAGGACATCTCGTAGTACTG GGGGGAGAGAGAGGGGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 79} {0: 1, 1: 6, 2: 102, 3: 1487, 4: 8655}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!