ID: 1161208916_1161208932

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161208916 1161208932
Species Human (GRCh38) Human (GRCh38)
Location 19:3056337-3056359 19:3056376-3056398
Sequence CCGTAGGACATCTCGTAGTACTG GGGGAGCGGGAGATGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 79} {0: 1, 1: 0, 2: 11, 3: 205, 4: 1685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!