ID: 1161208967_1161208983

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1161208967 1161208983
Species Human (GRCh38) Human (GRCh38)
Location 19:3056538-3056560 19:3056560-3056582
Sequence CCAGCATCCCAGCCCGCCCTGGA AGAGGGGCAGGGGGCCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 363} {0: 1, 1: 0, 2: 2, 3: 57, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!