ID: 1161210332_1161210347

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1161210332 1161210347
Species Human (GRCh38) Human (GRCh38)
Location 19:3062358-3062380 19:3062390-3062412
Sequence CCTCCCCGCGCGCCCGGCCCCGG GGCCCCGCTTCCTGCGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 24, 3: 217, 4: 1290} {0: 1, 1: 1, 2: 0, 3: 28, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!