ID: 1161224352_1161224367

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161224352 1161224367
Species Human (GRCh38) Human (GRCh38)
Location 19:3136254-3136276 19:3136302-3136324
Sequence CCACCGCCGAGCCGGGCTTCCTG TCCCTGGGGGGTGACCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160} {0: 1, 1: 0, 2: 0, 3: 20, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!