ID: 1161245554_1161245567

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1161245554 1161245567
Species Human (GRCh38) Human (GRCh38)
Location 19:3249720-3249742 19:3249762-3249784
Sequence CCAACTTGTGGTCCTCTCAGACC GGGGAAGGTGAGGCCCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120} {0: 2, 1: 15, 2: 226, 3: 1214, 4: 4282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!