ID: 1161245554_1161245569

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1161245554 1161245569
Species Human (GRCh38) Human (GRCh38)
Location 19:3249720-3249742 19:3249764-3249786
Sequence CCAACTTGTGGTCCTCTCAGACC GGAAGGTGAGGCCCAGAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120} {0: 3, 1: 11, 2: 132, 3: 611, 4: 1958}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!