ID: 1161249008_1161249023

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1161249008 1161249023
Species Human (GRCh38) Human (GRCh38)
Location 19:3270612-3270634 19:3270665-3270687
Sequence CCGGGCGGGCGGGCGGCGGCACG CGGTGGGTAAGGCGGGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 2071} {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!