ID: 1161267345_1161267347

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1161267345 1161267347
Species Human (GRCh38) Human (GRCh38)
Location 19:3370350-3370372 19:3370384-3370406
Sequence CCTCTGGGTCTCTCTGTGCATCT TCCCCCTCCCCTCTCTGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 54, 4: 426} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!