ID: 1161278803_1161278817

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1161278803 1161278817
Species Human (GRCh38) Human (GRCh38)
Location 19:3434096-3434118 19:3434149-3434171
Sequence CCCATGGCCTTGGTCCTCTGATC GGAACCGGGCCAATATGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!