ID: 1161284701_1161284718

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161284701 1161284718
Species Human (GRCh38) Human (GRCh38)
Location 19:3463302-3463324 19:3463340-3463362
Sequence CCCCTCAGCCCCCACCGAGGACG AAGGGAGACACAGCGGACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162} {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!