ID: 1161286364_1161286370

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161286364 1161286370
Species Human (GRCh38) Human (GRCh38)
Location 19:3470453-3470475 19:3470486-3470508
Sequence CCTACAGCTTCCTCCAGGTCAGG AACAACAAGTAGAAGTGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!