ID: 1161297220_1161297237

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1161297220 1161297237
Species Human (GRCh38) Human (GRCh38)
Location 19:3526198-3526220 19:3526245-3526267
Sequence CCATCCGCCCTGCAGGCCCCCAC CTTGGTGCCCGCAGACGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 534} {0: 1, 1: 0, 2: 0, 3: 13, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!