ID: 1161298482_1161298489

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1161298482 1161298489
Species Human (GRCh38) Human (GRCh38)
Location 19:3531709-3531731 19:3531740-3531762
Sequence CCTAGGGGAACCTGGTGGCGGTG CAAGGGCTTCGTGCAGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 183} {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!