ID: 1161300475_1161300479

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1161300475 1161300479
Species Human (GRCh38) Human (GRCh38)
Location 19:3540181-3540203 19:3540207-3540229
Sequence CCTCCCAGGTTCTAGGATTCTTC CTCAAGCCTTCTGAGTAGCTAGG
Strand - +
Off-target summary No data {0: 6, 1: 121, 2: 790, 3: 13295, 4: 128207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!